|
Bacterial Pathogens in FoodWaterborne Disease The Pediatric Bulletin Myrna R. Nieves, MD FAAP
Title: Bacterial Pathogens in FoodWaterborne Disease The Pediatric Bulletin Myrna R. Nieves, MD FAAP
Category: Science & Technology / Biology
Details: Words: 5095 | Pages: 21.7 (approximately 235 words/page)
Bacterial Pathogens in FoodWaterborne Disease The Pediatric Bulletin Myrna R. Nieves, MD FAAP
Bacterial Pathogens in FoodWaterborne Disease
The Pediatric Bulletin
Myrna R. Nieves, MD FAAP
http://home.coqui.net/myrna/food.htm (10/03/04)
SHIGELLA
Shigella spp. were the second most common cause of bacterial foodborne illnesses reported by the CDC from 1983 to 1987 and the leading cause in bacterial waterborne outbreaks during 1986 to 1992 in the US. There are four species: Shigella dysenteriae, Shigella flexneri, Shigella boydii, and Shigella sonnei. Although this pathogen has been reported in contaminated food and …showed first 75 words of 5095 total…
You are viewing only a small portion of the paper.
Please login or register to access the full copy.
|
|
…showed last 75 words of 5095 total…the ELISA plate and binds via the biotin-streptavidin interaction. Detection of the bound complex is accomplished via a simple alkaline phosphatase labeled antibody directed against digoxigenin, with color developed using a suitable substrate (Sethabutr et al, 2000). Forward primer H8 GTTCCTTGACCGCCTTTCCGATACCGTC Reverse primer H15 GCCGGTCAGCCACCCTCTGAGAGTAC ( Sethabutr et al., 2000 )
4. Other Types of Diagnostic Tests:
No other tests available here.
Updated: 2001
The Hastings & Prince Edward Counties Health Unit
http://www.hpechu.on.ca/Topics/InfectiousDiseases/shigella.htm (10/03/04)
Need a custom written paper?
|
|
